搜索结果：Biochimica et biophysica acta

The present study extends our previous experimental investigation of liposome-amyloid composite nanocarriers for doxorubicin (DOX) delivery by providing a mechanistic analysis of how experimentally observed loading and release parameters influence drug depot behavior and systemic exposure. In our earlier work, the encapsulation capacity and release kinetics of DOX were characterized for phosphatidylcholine (PC) liposomes, cardiolipin (CL)-containing liposomes, lysozyme and insulin amyloid fibrils (LzF and InsF), and their corresponding composite systems. Here, the experimentally determined retained drug fractions and apparent release constants were used as input parameters for computational analysis of drug release, depot depletion, and systemic pharmacokinetic behavior. Using a first-order kinetic framework combined with a two-compartment pharmacokinetic model, theoretical release profiles, depot persistence, and plasma concentration-time curves were reconstructed to compare the investigated formulations under identical conditions. The results demonstrate that formulation composition strongly affects depot size and release dynamics, which subsequently reshape systemic exposure profiles. Systems with higher retained drug fractions were shown to form larger depots and produce delayed and reduced peak concentrations, whereas low-loading formulations allow rapid systemic drug availability. Whereas our previous experimental study identified PC+InsF composites as the most promising systems based on encapsulation efficiency and fluorescence-derived characteristics, incorporation of release kinetics and pharmacokinetic modeling in the present work indicates that PC+LzF systems offer a more advantageous balance between depot persistence and systemic exposure. However, this finding requires experimental validation under physiological conditions before solid translational conclusions can be drawn. Overall, the study demonstrates how computational pharmacokinetic modeling can extend experimental characterization and support the rational design of hybrid protein-lipid nanocarriers for controlled drug delivery.

Membrane-bound decarboxylases couple carboxylic acid decarboxylation to the transport of Na+ ions out of prokaryotic cells. The molecular mechanism of decarboxylase action is not yet known, which contrasts with the progress achieved in studying other primary ion pumps. Measuring decarboxylase activity is complicated by slow keto-enol tautomerization of the substrates during the assay. We found that HEPES exhibits anomalously high efficiency as a general acid catalyst for CH bond formation during the enol-to-ketone conversion of oxaloacetate. Accordingly, the addition of HEPES to the assay medium eliminated the contribution of tautomerization rate to measured decarboxylation rate. Using the dependence of oxaloacetate tautomerization rate and equilibrium on solvent properties and pH, we established that only the keto form of oxaloacetate is converted by Vibrio cholerae oxaloacetate decarboxylase. Steady-state kinetic measurements did not reveal cooperativity in oxaloacetate conversion and Na+ binding. The effects of ionophores (CCCP, valinomycin, and ETH157) on proton transport in pyranine-loaded membrane vesicles prepared from V. cholerae cells indicated that the proton required for the conversion of oxaloacetate to pyruvate is taken up from the cytoplasmic side of the membrane. Furthermore, the effects suggested that ΔpH generation is caused by secondary electrophoretic proton transport in exchange for Na+. These findings advance our understanding of the molecular mechanism of the decarboxylation-supported Na+ transport in bacteria.

Cell chirality is a newly discovered cellular characteristic that is phenotype-specific and is associated with cell migration, cell differentiation, organelle positioning, and organ asymmetry. The maintenance of normal cellular chirality is fundamental for preserving physiological functions in organisms. In recent years, cellular chirality has been increasingly investigated in tumor research, especially metastasis. During tumor metastasis, tumor cells acquire migratory and invasive capabilities through epithelial-mesenchymal transition (EMT), a process that is intricately linked to the dynamic reprogramming of cell chirality. The alterations in the chirality of both tumor cells and other surrounding cells significantly enhance metastatic efficiency not only by regulating cell-extracellular matrix interactions, collective migration patterns, and immune escape but also by increasing vascular permeability. This article provides a comprehensive and systematic exploration of the intricate relationship between cell chirality and tumor metastasis. It meticulously summarizes the molecular mechanisms that govern cell chirality, outlines the commonly employed detection methods, and delves into the potential therapeutic strategies targeting cellular chirality. Given the pivotal role of cell chirality in regulating metastasis, further research in this area holds great promise for revolutionizing cancer treatment and is expected to pave the way for the development of novel therapeutic strategies targeting tumor metastasis.

Diabetes mellitus (DM)-induced cardiac arrhythmia involves complex pathophysiological processes, in which mitochondrial dysfunction and mitochondrial oxidative stress are recognized as central mediators. Recently, conditionally immortalized rat atrial myocyte lines (iAMs) were developed, allowing doxycycline-dependent switching between proliferative and contractile states. These iAMs offer a promising model for studying atrial arrhythmias and dysfunction. Whether these cells can be used as a model to study diabetes-induced mitochondrial dysfunction, and whether this is a viable target for prevention, remains unclear. To study this, we firstly characterized the mitochondrial function in iAMs and found that high glucose (HG) treatment of differentiated iAMs induced a diabetic state marked by mitochondrial dysfunction, production of reactive oxygen species, and (mitochondrial) oxidative stress, which were associated with contractile dysfunction and arrhythmogenesis. These HG-induced changes were prevented by the mitochondria-targeted antioxidant, MitoTEMPO. Findings were validated in an in vivo diabetic Drosophila model. Taken together, we established HG-treated iAMs as a model for diabetes-related cardiac arrhythmias and dysfunction, as well as for screening of therapeutic interventions, and identified mitochondrial oxidative stress as a potential therapeutic target.

Cancer Stem Cells (CSCs) are the core drivers of esophageal cancer recurrence, metastasis, and treatment resistance, and their metabolic reprogramming characteristics provide an important entry point for targeted therapy. This study aimed to explore the role and regulatory mechanism of HACD1 (3-Hydroxyacyl-CoA Dehydrogenase 1), a key enzyme in lipid metabolism, in maintaining the stemness of esophageal cancer. Using the Patient-Derived Xenograft (PDX) cell line HD-12 and laboratory cell lines TE-1 and KYSE-150, a Tumoursphere (TS) stemness enrichment model was constructed, and systematic analysis was conducted by combining quantitative Polymerase Chain Reaction (qPCR), transcriptome sequencing, lipidomics, functional experiments, and animal models. The results showed that the upregulation of stemness markers (Oct4(Octamer-binding transcription factor 4), Sox2 (SRY-box transcription factor 2), etc.) in PDX-derived HD-12 tumourspheres was significantly higher than that in laboratory cell lines, with unique transcriptomic characteristics. Lipidomics confirmed that lipid metabolites such as Triglycerides (TG) and Long-Chain Fatty Acids (LCFA) were significantly enriched in tumourspheres. The HACD (3-Hydroxyacyl-CoA Dehydrogenase) family was specifically highly expressed in stem cells, and the enzymatic activity of HACD1 (3-hydroxyacyl-CoA dehydratase 1) was positively correlated with the stemness phenotype. HACD1 knockdown significantly inhibited esophageal cancer tumoursphere formation, cell migration, and in vivo tumourigenic ability, and downregulated the expression of stemness markers; exogenous supplementation of Docosahexaenoic Acid (DA) could reverse this inhibitory effect in a concentration-dependent manner. Metabolic analysis indicated that tumoursphere cells rely on both glycolysis and lipid oxidation for energy supply and possess metabolic flexibility, and blocking a single pathway cannot effectively inhibit stemness. This study is the first to confirm that HACD1 maintains the stemness phenotype of esophageal cancer by regulating lipid metabolism. The PDX model exhibits a unique stemness regulatory pattern closer to clinical practice, providing new molecular targets and experimental basis for the metabolic targeted therapy of esophageal cancer.

Immune evasion in colon cancer (CC) is largely driven by the functional suppression of NK cells, yet the specific regulatory role of ETV4 in this process remains poorly defined. We first analyzed ETV4 expression levels in CC through bioinformatics prediction and qPCR validation. A tumor-NK cell co-culture system was established to assess NK cell cytotoxicity and glycolytic metabolic profiles, which were examined via Seahorse and lactate/glucose assays. A nude mouse xenograft model combined with the glycolysis inhibitor 2-DG was applied for validation. ETV4 was significantly upregulated in CC tissues, and its high expression correlated with adverse clinical prognosis and decreased intratumoral NK cell infiltration. ETV4 potentiated tumor glycolysis by upregulating the expression of key glycolytic enzymes LDHA and PDK1, which consequently impairs NK cell cytotoxicity and the production of NK cell effector molecules. Glycolysis inhibition reversed this NK-cell suppression. ChIP-qPCR and dual-luciferase reporter assays validated that ETV4 transcriptionally activated LDHA. In vivo, ETV4 accelerated tumor growth via glycolysis, and this effect was blocked by 2-DG treatment. In conclusion, by transcriptionally activating LDHA, ETV4 facilitates glycolysis and thereby inhibits NK cell-mediated antitumor immunity in CC The ETV4-glycolysis axis may serve as a therapeutic target.

Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ) are central downstream effectors of the Hippo pathway and play key roles in hepatic metabolic regulation. However, the molecular mechanisms by which YAP/TAZ modulate lipid processing in hepatocytes remain incompletely understood. In this study, we investigated a YAP/TAZ-dependent non-coding RNA regulatory network controlling low-density lipoprotein receptor (LDLR) expression and lipid droplet accumulation in human hepatic cells. Using transcriptomic profiling combined with functional validation in human hepatocellular carcinoma cells, we identified the long non-coding RNA Shwachman-Bodian-Diamond Syndrome Pseudogene 1 (SBDSP1) as a YAP/TAZ-downstream transcript that positively regulates LDLR expression. Silencing of YAP/TAZ significantly reduced SBDSP1 levels, accompanied by downregulation of LDLR mRNA and protein, impaired LDL uptake, and reduced intracellular lipid droplet accumulation. Mechanistically, SBDSP1 was predicted to interact with miR-29a-5p, a microRNA putatively targeting the 3' untranslated region of LDLR. Knockdown of SBDSP1 or mimicking of miR-29a-5p decreased LDLR expression and reduced lipid accumulation, while luciferase reporter assays confirmed direct interactions between miR-29a-5p and both SBDSP1 and LDLR. Collectively, these findings describe a potential YAP/TAZ-SBDSP1-miR-29a-5p-LDLR regulatory axis that controls hepatic lipid uptake and accumulation. This study provides molecular insights into the interplay between Hippo pathway signaling and non-coding RNA networks to regulate lipid metabolism, highlighting a potential regulatory mechanism that may be relevant to hepatic lipid accumulation in metabolic dysfunction-associated steatotic liver disease.

Metformin is the most common drug for type 2 diabetes due to its action to improve insulin sensitivity and enhance glucose uptake in tissues, including adipose tissue. As a mitochondrial complex I inhibitor, treatment with metformin may cause deleterious effects. Here, we demonstrated that treatment of adipocytes 3 T3-L1 cells with a high concentration of metformin (10 mM) led to increased reactive oxygen species (ROS) accumulation and triggered the mitochondrial unfolded protein response (UPRmt), as revealed by increased mRNA expression of UPRmt markers (mtHSP70, Lonp1, and FGF21). High-concentration metformin also induced COX-2 inflammation, as indicated by increased NF-κB phosphorylation and cyclooxygenase-2 (COX-2) expression. By contrast, a lower concentration (1.25 mM) showed no effects. We found that ATF4 was selectively upregulated and was required for UPRmt and COX-2 inflammation induced by metformin. Interestingly, we showed that the integrated stress response inhibitor (ISRIB) effectively inhibited ATF4, mitigated metformin-induced UPRmt, and reduced NF-κB/COX-2 expression. Taken together, our findings point to the undesirable effect of the high-concentration metformin in adipocytes.

Central nervous system tumors represent a heterogeneous group of diseases, mainly localized in the brain. Among them, malignant brain tumors represent some of the most aggressive cancers. In adults, only approximately 30% of patients diagnosed with glioblastoma survive beyond two years. Similarly, several pediatric-predominant brain tumors, including medulloblastoma, diffuse intrinsic pontine glioma, and ependymoma, remain among the deadliest solid tumors in children. Therefore, a deeper understanding of brain tumor biology is imperative for the development of more effective therapeutic strategies. Dysregulated epigenetic control has emerged as a critical driver of brain tumor initiation and progression, influencing malignant phenotypes across multiple stages of the disease. Epigenetic mechanisms, including DNA methylation, histone modifications, chromatin remodeling, and non-coding RNAs, regulate gene expression programs that contribute to all hallmarks of cancer by modulating the activity of tumor suppressor genes and oncogenes. Given the central role of epigenetics in brain tumorigenesis and the potentially reversible nature of these alterations, epigenetic mechanisms represent particularly attractive therapeutic targets. Although several epigenetic drugs have shown promising results in preclinical and clinical studies, their clinical application remains constrained by a limited knowledge of the brain tumor epigenome and by challenges related to tumor location and drug delivery. In this review, we summarize key epigenetically regulated genes and dysregulated microRNAs across major brain tumor types and link these alterations to specific cancer hallmarks. We further highlight representative examples of epigenetic therapies whose effects converge on hallmark-associated oncogenic processes.

Despite a significant increase in clinical trials for biliary tract cancers (BTCs) over the past decade, progress in precision therapy has been limited by insufficient understanding of treatment strategies and target specificity. Based on 873 clinical trials for BTCs from the Informa database, we conducted an analysis of the geographical distribution, research phase, treatment modalities, and target characteristics for BTCs over the past decade. We further integrated transcriptomic and proteomic data from the Human Protein Atlas (HPA) to evaluate the differential expression of targets in normal and tumor tissues. The specificity and potential of targets were further analyzed. Clinical trials for BTCs exhibited region-specific dominance, with China and the United States accounting for 35% and 32.5% of trials, respectively. Current major breakthroughs in clinical trials involve combination therapies. Globally, chemotherapy combined with targeted therapy is predominant, whereas China primarily focuses on chemotherapy combined with immunotherapy. Hepatic arterial infusion chemotherapy (HAIC) combined with targeted/immunotherapy represents a distinctive treatment strategy in China. Innovative therapies, such as antibody-drug conjugates (ADCs) and cancer vaccines, are primarily in Phase I/II. The VEGF pathway, FGFR fusions, and HER2 amplification have garnered significant attention for clinical translation. CHEK1, ATR, DNMT1, AURKA, and CA9 represent potential targets demonstrating high safety and specificity. This study provides a comprehensive analysis of the clinical trial landscape for BTCs and evaluates the safety and specificity of therapeutic targets, serving as a reference for future BTC research.

Cardiometabolic diseases are driven by persistent crosstalk between metabolic dysfunction and chronic low-grade inflammation. Orosomucoid 2 (ORM2), a highly glycosylated acute-phase protein of the α1-acid glycoprotein family, has conventionally been considered a circulating inflammatory marker. Recent evidence, however, suggests that ORM2 may also function as an active immunometabolic regulator linking hepatic stress responses, adipose tissue inflammation, macrophage polarization, and systemic metabolic homeostasis. This review summarizes the molecular characteristics, tissue distribution, glycosylation-dependent biology, and stress-responsive regulation of ORM2, with emphasis on cytokine-induced JAK/STAT and NF-κB signaling, hepatic and extrahepatic ORM2 expression, and potential glycoform-specific regulation. Macrophage polarization is discussed as a central mechanism through which ORM2 may modulate inflammatory resolution, adipose-liver communication, insulin sensitivity, vascular inflammation, and myocardial injury. Particular attention is given to the possibility that increased ORM2 may represent a compensatory response to inflammatory-metabolic stress rather than simply a marker of disease burden. The translational potential of ORM2 is also considered, including its possible use in multi-marker biomarker panels for cardiometabolic risk stratification and treatment monitoring. However, major limitations remain, including incomplete mechanistic knowledge, unclear receptor biology, limited data on ORM2 glycosylation in specific cardiometabolic phenotypes, assay standardization issues, and insufficient prospective clinical validation. In summary, ORM2 appears to be a biologically plausible mediator linking inflammation and metabolism, but further mechanistic and clinical studies are required to establish its causal role, biomarker value, and therapeutic potential in cardiometabolic disease.

Consumption of a high-fat diet (HFD) diet is a factor associated with several diseases including obesity and its associated complications, especially liver and kidney dysfunction via promoting derangement of lipid metabolism. It has been reported that fructooligosaccharides (FOS) improve insulin sensitivity and ectopic lipid accumulation. The aim of this study was to investigate the effects of FOS on insulin resistance, liver and renal lipid accumulation, inflammasome formation, oxidative stress and intestinal barrier integrity in an obese rat model. Male Wistar rats were fed a normal (ND) or HFD for 16 weeks. The rats given a HFD were then given FOS at 1 or 2 g/day and metformin at 30 mg/kg/day daily for 8 weeks by oral gavage. The results demonstrated that FOS and metformin improved insulin resistance. FOS showed greater efficacy than metformin in attenuating intestinal barrier leakage. FOS and metformin decreased liver lipid synthesis as evidenced by the downregulation of SREBP1c, FAS and perilipin2. Renal lipid accumulation was restored concomitant with the reduction in renal lipid content and lipotoxicity. Liver and renal inflammation and organ injury were restored to within normal limits. However, FOS had no effect on the antioxidant enzymes via KEAP1/NRF2. Metformin attenuated renal oxidative stress via the suppression of PKCα and the FOXO1 signaling pathway. These suggest that FOS and metformin have the potential to improve gut health and prevent liver and renal complications and could be used as a useful supplement in the obese condition.

The absence of known inhibitors for TNFAIP1, a TNF-α-induced protein, has limited its exploration as a therapeutic target for ulcerative colitis (UC). This study aimed to validate TNFAIP1's pathogenic role in UC and to identify the first direct TNFAIP1-targeting compound from natural compounds. We integrated bioinformatics analysis, DSS-induced colitis models in Tnfaip1-knockout mice, and virtual screening to identify Salidroside as a potential TNFAIP1-targeting compound. Cellular thermal shift and ubiquitination assays confirmed its direct interaction with TNFAIP1 and its effect on protein stability. Oral administration of Salidroside ameliorated colitis in wild-type mice, phenocopying the protective effect of Tnfaip1 deficiency. TNFAIP1 was significantly upregulated in UC patients and colitic mice. Tnfaip1-knockout conferred profound resistance to colitis, mechanistically linked to the suppression of the IKK/IκB/NF-κB pathway, modulation of CREB signaling, and restoration of a beneficial gut microbiota. Based on this target validation, virtual screening identified Salidroside as a top candidate. Crucially, Salidroside administration in wild-type mice phenocopied the protective effects of genetic knockout, alleviating disease severity and downregulating the TNFAIP1-driven inflammatory network. CETSA confirmed a direct physical interaction between Salidroside and TNFAIP1. This study validates TNFAIP1 as a key pathogenic driver of UC and identifies Salidroside as a first-in-class direct TNFAIP1-targeting compound with therapeutic potential.

Exosomal miRNAs mediate intracellular communication between the tumor microenvironment and cancer cells in non-small cell lung cancer (NSCLC). However, effects of exosomal miRNAs on NSCLC and its mechanisms have not been completely clarified. Here, exosome miRNA profiling and patient serum analysis revealed that the expression level of exosomal miR-664b-5p is significantly elevated in NSCLC, with particularly high levels in cancer-associated fibroblasts (CAFs) and their secreted exosomes. Functionally, miR-664b-5p promotes cell proliferation, migration, and invasion and inhibits apoptosis, thereby promoting malignant progression and metastasis in NSCLC. Moreover, experiments in a CAF-organoid coculture system and a CAF-NSCLC cell coinjection animal model demonstrated that exosomal miR-664b-5p is derived primarily from CAFs and is transferred to NSCLC cells via exosomes, contributing to the malignant phenotype of NSCLC cells, whereas miR-664b-5p knockdown in CAFs attenuated their tumor-promoting ability. Further exploration revealed that G protein γ subunit 11 (GNG11) is a direct functional target gene of miR-664b-5p. GNG11 expression is negatively correlated with miR-664b-5p expression, and ectopic expression of GNG11 partially abrogates the malignant phenotypes induced by miR-664b-5p overexpression in NSCLC. Mechanistically, CAF-derived exosomal miR-664b-5p facilitates NSCLC progression and metastasis by downregulating GNG11, which correlated with activation of the CXCL12/CXCR4 chemokine pathway. Serum exosomal miR-664b-5p levels were positively correlated with tumor burden. Taken together, the results of our study reveal that exosomal miR-664b-5p derived from CAFs can be transferred to NSCLC cells to promote NSCLC progression and metastasis via the CXCL12/CXCR4 axis, supporting the potential of exosomal miR-664b-5p as a biomarker and therapeutic target for NSCLC.

Asthma is a chronic airway disease characterized by airway inflammation and remodeling. While 15-hydroxyprostaglandin dehydrogenase (15-PGDH) and its metabolic product 15-oxo-5Z,8Z,11Z,13E-eicosatetraenoic acid (15-oxoETE), are known to participate in inflammatory regulation in several diseases its specific role in asthma remains unclear. In this study, we revealed a significant and concurrent upregulation of both 15-PGDH and 15-oxoETE in the lung tissues of asthmatic mice. In vitro, TNF-α stimulation increased 15-PGDH expression in bronchial epithelial cells. Mechanistically, 15-PGDH/15-oxoETE drove epithelial cell senescence and pro-inflammatory cytokine release, which was mediated by 15-oxoETE directly binding to and stabilizing IGFBP5. Notably, SW033291, a selective 15-PGDH inhibitor, prevented and alleviated airway inflammation and remodeling in acute asthmatic mice, while also exerting significant therapeutic effects in chronic asthma models. In summary, 15-PGDH/15-oxoETE acts as a critical driver of airway inflammation and epithelial senescence in asthma, and targeting this pathway may provide a promising therapeutic strategy.

Colorectal liver metastasis (CRLM) remains the primary cause of mortality in patients with colorectal cancer (CRC). Despite its clinical significance, the complex molecular networks and microenvironmental dynamics driving CRLM remain incompletely understood. Identifying robust prognostic biomarkers and elucidating their underlying mechanisms are of critical importance for advancing targeted interventions. We integrated Weighted gene co-expression network analysis (WGCNA) with differential expression profiling to identify the CRLM-associated hub genes. The clinical relevance and spatial expression of the identified target, SERPING1, were validated in human CRC and CRLM tissue cohorts. In vitro functional assays (siRNA knockdown) and transcriptomic enrichment analyses were performed to evaluate the impact of SERPING1 on malignant epithelial phenotypes. Finally, Single-cell RNA sequencing (scRNA-seq) and immune infiltration algorithms were utilized to delineate its distribution within the tumor microenvironment (TME). SERPING1 was identified as a critical prognostic hub gene, with its elevated expression significantly correlating with poor patient survival and exhibiting a stepwise upregulation along the primary-to-metastasis axis in clinical tissues. In vitro, silencing SERPING1 attenuated the proliferative, migratory, and invasive capacities of CRC cells. This was accompanied by a molecular shift away from the epithelial-mesenchymal transition (EMT) program, supported by the enrichment of classical pro-metastatic cascades. Crucially, scRNA-seq and microenvironmental analysis revealed that in vivo, SERPING1 is predominantly enriched within cancer-associated fibroblasts (CAFs), establishing a strong correlation with stromal infiltration. These findings suggest that SERPING1 serves as a crucial molecular nexus in CRLM, potentially facilitating disease dissemination by supporting malignant EMT phenotypes and participating in stromal TME remodeling. Consequently, SERPING1 represents a promising biomarker and a potential therapeutic target for mitigating CRLM.

Hypoxia-inducible factor 1-alpha (HIF1A) is a core regulator of cellular adaptation to hypoxic environments and is extensively involved in various cancer processes. Although it is known that HIF1A produces two isoforms, HIF1A-L and HIF1A-S, through the alternative splicing of exon 14, the specific functional differences between these isoforms in cancer development and progression remain unclear, and the molecular mechanisms regulating this exon skipping event have yet to be elucidated. Clinical IHC and FISH analyses demonstrate that HIF1A-L expression is elevated in high-grade breast cancer tissues and correlates with malignant progression. Using transcriptomics and functional assays, we demonstrate that HIF1A-L enhances, while HIF1A-S inhibits, cancer cell proliferation, migration, and invasion. Mechanistically, through luciferase reporter and Western blot analyses, we found that HIF1A-L upregulates CXCR4 to activate the AKT pathway, whereas HIF1A-S antagonizes this axis. Furthermore, via CL-RIP, MS2-RIP, and RNA-pull down assays, we identify the RNA-binding protein HNRNPF as the key upstream regulator that specifically binds to a conserved G-rich sequence (gggaggtggaggttgcgatgagctgagatcagg) within intron 13 of HIF1A pre-mRNA to promote exon 14 retention and HIF1A-L production. Critically, in vivo metastasis assays in nude mice reveal that knockdown of HNRNPF or HIF1A-L suppresses lung metastasis, along with reduced CXCR4 in lung tissues and lower serum levels of the pro-metastatic cytokines IL-6 and CXCL12, whereas knockdown of HIF1A-S exacerbates metastasis. This study elucidates the HNRNPF/HIF1A-L/CXCR4/AKT axis as a central regulatory circuit controlling breast cancer metastasis and suggests that correcting the aberrant splicing of HIF1A may represent a novel therapeutic strategy for cancer.

Neuroblast cells play a pivotal role in adult neurogenesis. However, the detailed mechanisms underlying the acquisition of pluripotency or the process of differentiation remain unknown. Herein, the role of the AT-hook protein AKNA in regulating pluripotency and stemness in neuroblastoma cells is demonstrated through gene knockdown, immunofluorescence, chromatin immunoprecipitation (ChIP), localization of AKNA, signaling interactions, and transcriptional activity. AKNA was detected primarily in the nucleus during the induction of pluripotency and was retained in the cytosol by FAK signaling during differentiation. Loss of AKNA disrupts both the stemness and differentiation potential of neuroblastoma cells. In the nucleus, colocalization and physical association between AKNA and KDM6B promote H3K27me3 demethylation and subsequently H3K27ac deposition on the promoters of stemness genes, triggering their transcription. These findings establish AKNA as a critical regulator of neuroblast cell fate determinants in association with epigenetic modifiers and signaling pathways, offering potential targets for neuroblastoma therapies and regenerative medicine for neurodegenerative diseases.

Ribosomal L1 domain-containing protein 1 (RSL1D1) is an RNA-binding protein that relates to senescence. Nevertheless, the mechanism of RSL1D1 in modulating senescence and ferroptosis in diabetic retinopathy (DR) remains undefined. The DR mice were developed by intraperitoneal injection of STZ, and AAV targeting RPE was used for gene intervention. ARPE-19 cells were infected using oe-RSL1D1 and sh-FTH1 lentivirus before 30 mM high glucose (HG) exposure. Cell damage was assessed by measuring the expression of senescence and ferroptosis markers in ARPE-19 cells, along with oxidative stress indicators and Fe2+ levels. RSL1D1 and FTH1 expression were significantly reduced in the retinal pigment epithelium (RPE) layer of diabetic mice and HG-induced ARPE-19 cells. Downregulation of RSL1D1 led to RPE cell senescence and dysregulated iron homeostasis-induced ferroptosis. HG treatment reduced the interaction between RSL1D1 protein and FTH1 mRNA in ARPE-19 cells, while RSL1D1 overexpression enhanced this interaction, thereby stabilizing FTH1 mRNA expression. The alleviating effects of RSL1D1 overexpression on retinal pigment epithelium cell senescence and ferroptosis in vitro and in vivo were compromised by FTH1 knockdown. Overall, this study unveils a posttranscriptional regulation of FTH1 by RSL1D1 and uncovers the implication of RSL1D1/FTH1 in cellular senescence and ferroptosis in DR.